SalI-HF R3138S from New England Biolabs

Product Specs
ItemSalI-HF
CompanyNew England Biolabs
Price Pricing Info Supplier Page View Company Product Page
Catalog NumberR3138S
Concentration20,000 units/ml
Quantity2000 units
ApplicationsDNA Manipulation
Brand/TrademarkNew England Biolabs Inc (NEB)
TypeRestriction Enzyme
Temperature-20 C

Sequence

G^TCGAC

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) A robust CRISPR interference gene repression system in Vibrio parahaemolyticusArch MicrobiolDecember 26, 2023Taoyuan Jiang, Yuhuan Li, Wencong Hong, Mingyu Lin(Cat#12,125). After methylation and DNA purification, the plasmid was subjected to restriction enzyme SalI (NEB, cat#R3138S) digestion, and reaction mixtures were analyzed by 1% agarose gel electrophoresis. The gel was then

(2) Metastases and treatment-resistant lineages in patient-derived cancer cells of colorectal cancerCommunications BiologyNovember 24, 2023Shiki Fujino, Norikatsu Miyoshi, Aya Ito, Rie Hayashi, Masayoshi Yasui, Chu Matsuda, Masayuki Ohue, Masafumi Horie, Shinichi Yachida, Jun Koseki, et al.RV_ccgcggtaccgtcgacttagtcgagtgcgtagtc). The vector, PL-SIN-Oct4-EGFP, was linearized by a restriction enzyme, SalI-HF (R3138S; New England Biolabs). The amplified fragments and linearized vector were used for the cloning reaction

(3) ELOA3 : A primate-specific RNA polymerase II elongation factor encoded by a tandem repeat gene clusterScience AdvancesNovember 24, 2023Marc A. J. Morgan, Saeid Mohammad Parast, Marta Iwanaszko, Yuki Aoi, DongAhn Yoo, Zachary J. Dumar, Benjamin C. Howard, Kathryn A. Helmin, Qianli Liu, William R. Thakur, et al.digesting the plasmid with Nhe I–HF (New England Biolabs, R3131S) and Sal I–HF (New England Biolabs, R3138S) restriction enzymes and inserting synthetic DNA G-block fragments (Integrated DNA Technologies) using

(4) Versatile generation of precise gene edits in bovines using SEGCPNBMC BiologyOctober 20, 2023Ming Wang, Fangrong Ding, Haiping Wang, Ling Li, Yunping Dai, ZhaoLin Sun, Ning Limutation was synthesized by Sangon Biotech and was cloned into the 5HR-pPGKneoDTA-ESSEE vector using SalI (R3138S, NEB) and NheI (R3131S, NEB), resulting in pMSTN-ESSEE (point mutation). Similarly, A 2-kb 3′ homologous

(5) Cancer Stem Cells Persist Despite Cellular Damage, Emergence of the Refractory Cell PopulationAnnals of Surgical OncologyOctober 1, 2023Ayumi Nagae, Norikatsu Miyoshi, Shiki Fujino, Masafumi Horie, Shinichi Yachida, Masaru Sasaki, Yuki Sekido, Tsuyoshi Hata, Atsushi Hamabe, Takayuki Ogino, et al.RV_ccgcggtaccgtcgacttagtcgagtcgagtcgttagc). Amplification. PL-SIN-Oct4-EGFP was linearized by a restriction enzyme, SalI-HF (R3138S; New England Biolabs). The amplified fragments and linearized vector were used for the cloning reaction

(6) An efficient cloning method to expand vector and restriction site compatibility of Golden Gate AssemblyCell Reports MethodsAugust 22, 2023Masato Sorida, Roberto Bonasio,Thermo Scientific,SM1331 BsaI-HFv2,NEB,R3733S BbsI-HF,NEB,R3539S AgeI-HF,NEB,R3552S BamHI-HF,NEB,R3136S EcoRI-HF,NEB,R3101L HindIII-HF,NEB,R3104S NcoI-HF,NEB,R3193S NotI-HF,NEB,R3189S SalI-HF,NEB,R3138S SpeI-HF,NEB,R3133S XbaI,NEB,R0145S XhoI,NEB,R0146S XmaI,NEB,R0180S KpnI-HF,NEB,R3142S NdeI,NEB,R0111S Smal,NEB,R0141S BbsI-HF,NEB,R3539M T4 DNA Ligase

(7) High-sensitive nascent transcript sequencing reveals BRD4-specific control of widespread enhancer and target gene transcriptionNat CommunAugust 17, 2023Annkatrin Bressin, Olga Jasnovidova, Mirjam Arnold, Elisabeth Altendorfer, Filip Trajkovski, Thomas A. Kratz, Joanna E. Handzlik, Denes Hnisz, Andreas Mayerby either conventional restriction enzyme cloning using BamHI-HF or SalI-HF (NEB, Cat.# R3136S and R3138S) or by Gibson Assembly (NEB, Cat.# E2611S). The primer sequences used for amplification are listed in

(8) Picolinic acid is a broad-spectrum inhibitor of enveloped virus entry that restricts SARS-CoV-2 and influenza A virus in vivoCell Reports MedicineAugust 15, 2023Rohan Narayan, Mansi Sharma, Rajesh Yadav, Abhijith Biji, Oyahida Khatun, Sumandeep Kaur, Aditi Kanojia, Christy Margrat Joy, Raju Rajmani, Pallavi Raj Sharma, et al.prepared as reported earlier (34, 45). Briefly, pCB3/T7 DNA was linearized using the SalI-HF enzyme (R3138S, NEB) and CVB3 RNA was produced by in vitro transcription reaction. The infectious RNA was transfected

(9) Dosage sensitivity to Pumilio1 variants in the mouse brain reflects distinct molecular mechanismsThe EMBO JournalJune 1, 2023Salvatore Botta, Nicola de Prisco, Alexei Chemiakine, Vicky Brandt, Maximilian Cabaj, Purvi Patel, Ella Doron‐Mandel, Colton J Treadway, Marko Jovanovic, Nicholas G Brown, et al.sequence (Addgene, pRK5‐Myc‐Parkin #17612) at the N‐terminal by using SalI (New England Biolabs, # R3138S) and NotI (New England Biolabs, #R0189S) restriction enzymes to replace Parkin with PUM1. For GST, the

(10) Regulatory architecture of housekeeping genes is driven by promoter assembliesCell reportsMay 30, 2023Dejosez M, Dall'Agnese A, Ramamoorthy M, Platt J, Yin X, Hogan M, Brosh R, Weintraub AS, Hnisz D, Abraham BJ, et al.protein,Prospec,PRO-2108 Recombinant Zfp143,Abnova,H00007702-P01 Restriction endonuclease SalI,New England Biolabs,R3138S Restriction endonuclease XbaI,New England Biolabs,R0145S Restriction endonuclease NheI,New England Biolabs

(11) Fortuitous somatic mutations during antibody evolution endow broad neutralization against SARS-CoV-2 Omicron variantsCell ReportsMay 30, 2023Jianbo Wu, Zhenguo Chen, Yidan Gao, Zegen Wang, Jiarong Wang, Bing-Yu Chiang, Yunjiao Zhou, Yuru Han, Wuqiang Zhan, Minxiang Xie, et al.,New England BioLabs,Cat#R3553L BamH1,New England BioLabs,Cat# R0136M XhoI,New England BioLabs,Cat#R0146L SalI-HF,New England BioLabs,Cat#R3138S 10× NEB buffer 2,New England BioLabs,Cat#B7002S Phusion High-Fidelity DNA Polymerase,Thermo Scientific,Cat#M0530L T4 DNA polymerase

(12) The ion channel CALHM6 controls bacterial infection‐induced cellular cross‐talk at the immunological synapseThe EMBO JournalApril 3, 2023Sara Danielli, Zhongming Ma, Eirini Pantazi, Amrendra Kumar, Benjamin Demarco, Fabian A Fischer, Usha Paudel, Jillian Weissenrieder, Robert J Lee, Sebastian Joyce, et al.SAS,639524 Collagenase type 2,Worthington‐Biochem,CLS‐2 Agel‐HF,NEB,R3552S HindIII‐HF,NEB,R3104S SalI‐HF,NEB,R3138S Assays and kits,Assays and kits,Assays and kits IL‐1 beta mouse uncoated ELISA Kit,Thermo Fisher Scientific,88‐7013‐22 Cytotox 96® non‐radioactive cytotoxicity assay

(13) Synthetic gene circuits for cell state detection and protein tuning in human pluripotent stem cellsMol Syst BiolNovember 11, 2022Laura Prochazka, Yale S Michaels, Charles Lau, Ross D Jones, Mona Siu, Ting Yin, Diana Wu, Esther Jang, Mercedes VÃ¡zquez-CantÃº, Penney M Gilbert, et al.obtained from Benenson lab at ETH Zurich was digested with 30 U of SalI‐HF (New England Biolabs (NEB), R3138S) and 30 U of NotI‐HF (NEB, R3189) using CutSmart Buffer in a total reaction volume of 50 μl for fours

(14) Systematic discovery and functional dissection of enhancers needed for cancer cell fitness and proliferationCell ReportsNovember 8, 2022Poshen B. Chen, Patrick C. Fiaux, Kai Zhang, Bin Li, Naoki Kubo, Shan Jiang, Rong Hu, Emma Rooholfada, Sihan Wu, Mengchi Wang, et al.FastDigest Esp3I,Thermo Fisher,Cat# FD0454 FastAP,Thermo Fisher,Cat# EF0651 MboI,NEB,Cat# R0147S SalI-HF,NEB,Cat# R3138S AgeI-HF,NEB,Cat# R3552S Gibson Assembly Master Mix,NEB,Cat# E2611S Quick ligation kit,NEB,Cat# M2200S T4

(15) Specific viral RNA drives the SARS CoV-2 nucleocapsid to phase separatebioRxivSeptember 14, 2022Christiane Iserman et al.kind gift from Tim Sheahan and Ralph Baric) was cloned into AGB1329 (pET30b-6xHis-TEV) using SALI (NEB R3138S) and NOTI (NEB R3189S) restriction cloning with addition of the restriction sites to pUC57–2019-ncov

(16) A Mutated Nme1Cas9 Is a Functional Alternative RNase to Both LwaCas13a and RfxCas13d in the Yeast S. cerevisiaeFrontiers in Bioengineering and BiotechnologyJune 2, 2022Yadan Zhang, Huanhuan Ge, Mario Andrea Marchisiodigested overnight by restriction enzymes such as EcoRI (NEB-R0101S), XbaI (NEB-R0145S), and SalI-HF (NEB-R3138S). Then, the reaction mixture underwent gel electrophoresis and the DNA fragments were purified by AxyPrep

(17) EBF1 nuclear repositioning instructs chromatin refolding to promote therapy resistance in T leukemic cellsMolecular CellMarch 1, 2022Yeqiao Zhou, Jelena Petrovic, Jingru Zhao, Wu Zhang, Ashkan Bigdeli, Zhen Zhang, Shelley L. Berger, Warren S. Pear, Robert B. Faryabiwere generous gifts from the Greenberg lab. 5 μg TRE3G-TRF1-puro was digested with SalI-HF (NEB cat# R3138S) and AscI (NEB cat# R0558S) at 37 °C for 2 hours to produce TRE3G-puro backbone. EBF1 CDS with proper

(18) Purification and cryo-EM structure determination of Arabidopsis thaliana GLR3.4STAR ProtocolsDecember 17, 2021Shanti Pal Gangwar, Marriah N. Green, Maria V. Yelshanskaya, Alexander I. SobolevskyBP912 Bluo-Gal,Life Technologies,Cat# 15519028 IPTG,Zymo Research,Cat# I1001-5 Sall-HF,New England Biolabs,Cat# R3138S Notl-HF,New England Biolabs,Cat#3189S Quick ligase,New England Biolabs,Cat#M2200 Monarch Plasmid Miniprep Kit

(19) Multiplexed characterization of rationally designed promoter architectures deconstructs combinatorial logic for IPTG-inducible systemsNature CommunicationsDecember 1, 2021Timothy C. Yu et al.Wizard SV Gel and PCR Clean-up System (#A9281), and digested with SbfI-HF (NEB #R3642S), SalI-HF (NEB #R3138S), and rSAP (NEB #M0371S) for 1.5 h at 37 °C. Insert (library) and vector (pLibAcceptorV2) were ligated

(20) Fetuin-A is a HIF target that safeguards tissue integrity during hypoxic stressNature CommunicationsDecember 1, 2021Stefan Rudloff, Mathilde Janot, Stephane Rodriguez, Kevin Dessalle, Willi Jahnen-Dechent, Uyen Huynh-Dovector carrying the promoter fragments using BamHI and SalI restriction enzymes (both NEB, R3136S and R3138S). Primer and fragment sequences are listed in Supplementary Table 6. For in situ hybridization, the

Write a Review

(1)

4/11/2018Diagnostic Restriction Mapping Of Plasmid Constructs With SalI-HF Triveni MahendrappaI routinely construct several different types of plasmids for cloning and expression purposes. I have constructed plasmid of a size 6134 bp. After transforming it into suitable E. coli cells, colonies... Read Review

SalI-HF

SalI-HF from New England Biolabs

Description

Sequence

New England Biolabs

Citations (58)

Reviews

SalI-HF from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map